Back to

Exhibit 1

The "Reinventing Government" Report Card

Category

Grade

Comments

Downsizing

B

Accomplished the goal, but planning to match the downsized workforce with agency missions was weak.

Identifying objectives of government

D

The NPR sought in 1995 to focus on what government should do—but the effort evaporated as the Republican threat faded.

Procurement reform

A

Fundamental transformation of procurement system. Some vendors complain, but the system is far more efficient than it was.

Customer service

B+

Great progress in some agencies, but major failures in othersnotably the IRS.

Disaster avoidance

B-

Substantial efforts in many agencies, notably FEMA. Spectacular failures in others, notably the IRS. The big test: the Y2K problem.

Political leadership

C+

Consistently strong leadership from the top but inconsistent below. Federal workers have gotten mixed signals.

Performance improvements

C+

Linkage of NPR with the Government Performance and Results Act is inconsistent.

Improved results in "high-impact" programs

INC

Good strategy—but likelihood of achieving goals is low.

Service coordination

INC

Efforts to improve the coordination of service delivery are embryonic.

Relations with Congress

D

Efforts to develop legislative support for NPR initiatives have, with the exception of procurement reform, been weak and ineffective. Support from Congress: poor.

Improvements in citizen confidence in government

C

The steady slide in public trust and confidence in government has ended, but that has more to do with a healthy economy than improved government performance.

Inspiration from other governments, private-sector reforms

B-

Wide survey of other ideas—but more a grab-bag of options than a careful analysis of which ones fit federal problems.

Effort

A+

No administration in history has invested such sustained, high-level attention to management reform efforts.

OVERALL GRADE

 

B

Substantial progress made over first five years, but much more work lies ahead. Successive administrations will have little choice but to continue the NPR in some form.

Locus Marker name Position (Mb) Heterozygosity Forward primer (5′→3′) Reverse primer (5′→3′) 
 1 6SL001 0.04 0.9122 CCTCACCCGATACATAGACATAGG AGAAATACCGAAATAAGGCCTCC 
 2 6SL002 0.19 0.6687 CTCTCGCTACTGTGGTACATGC CAAACTGTAAGTCATGACCATGC 
 3 DNRNGCA 0.45 0.8103 GGAGAGAGCACTAGATTCCT CTCTAGCAAAAGGAAGAGCC 
 4 RING3CA 0.47 0.7577 TGCTTATAGGGAGACTACCG CACTCTGGAAACTTCCCATC 
 5 D6S2658 0.51 0.6063 AGAGAATGGATGCTGCATGAGG GAGAGCTGGACTTTCGGGTTATACA 
 6 6BO001 0.56 0.6621 AGGGAATTCGGAACTCATTTTT GTAAACTGGGCTGAGATGTACCA 
 7 TAP1 0.59 0.6521 AGAACCAGACAGGTTTCTCCTG GGACAATATTTTGCTCCTGAGGTA 
 8 D6S2444 0.69 0.7239 GAATGCTGGGTTCTTGGCTC GGAAGGATTCTAAATAGGGGAG 
 9 G511525 0.74 0.7727 GGCCAGTCAGGAATTTTACC GACAGCTCTTCTTAACCTGC 
10В D6S1666В 0.79В 0.8812В CTGAGTTGGGCAGCATTTGВ CAACTCCAAAATGCTGGGTВ 
11В D6S2665В 0.98В 0.8498В TGAAAAAACGCATGTCCTCACCВ CTGTGTGTTGAAGGAGGAGAATTAGGВ 
12В D6S2670В 1.35В 0.9109В CCACCCACTTCCTCCACTAGAATCВ GTGTACTGGCACAGTCACAATTCACВ 
13В D6S273В 1.67В 0.7671В GCAACTTTTCTGTCAATCCAВ CCGAAAATTTGAAGTTTGGTВ 
14В D6S2671В 1.77В 0.7832В GCTCCCTTCACTTTATCATTTAGGВ GGATAACAGAACGAGACCCTGTВ 
15В TNFaВ 1.82В 0.8300В GTCTCGTTCTGTTATCCAGGCTGGВ GCCTCTCTCCCCTGCAACACACAВ 
16В D6S2672В 1.88В 0.8608В CAAACCAATCAGGGTGGCTAВ GAAGCAGTATACAGGGGCTTCAGВ 
17В MICAВ 1.97В 0.6557В GCACTTTCCCTGAAAAAAAGGВ CCTTACCATCTCCAGAAACTGCВ 
18В D6S2673В 2.00В 0.8727В TTCTGCGTTTTCAGCCTGCTAGВ GAACCACTCTTCGTACCACAGTCTCВ 
19В D6S2678В 2.14В 0.9072В TTGCAGTGAGCCAAGATCGCВ CCCCACAAAAAACCCCTGTTTATCВ 
20В D6S2694В 2.33В 0.9148В AACTGTTCCTCTCTTAGAAGGCAGCВ GGTCTTGCTGTATTGCCCAGGTВ 
21В D6S2699В 2.49В 0.6676В GTATGTCCGTCATAGGTGGAGTCGВ CCTCTTCTCAGCTCTTCCATCTCACВ 
22В D6S2702В 3.00В 0.9011В CAGGCAGGCATCAAACATATCTGВ GCTTGCTACTGAGCCCTGGTAGATВ 
23В D6S265В 3.33В 0.7606В AGGTTAATGGGTACGAACGTВ ATCGAGGTAAACAGCAGAAAВ 
24В D6S478В 3.54В 0.8364В CCTCCATAATTGTGTGAGCCВ TGCTTGGGTTAGAAGATTGGВ 
Demigod
Symbol: The Scythe, The Sword, And The HourglassThe Scythe, Longsword & hourglass.jpg
  • "same as her father."
Home Plane: The Material Plane, City of Fate "Scramble & Lillam's Personal Plane" & All Transitional Planes
Alignment: Lawful Neutral
Portfolio: Vindicators, Charm, Knowledge, Courage, Celerity, Vengeance, Inquisition, Law, Magic,
Clergy Alignments: Lawful Neutral, Lawful Good, True Neutral, and Lawful Evil
Domains: Law, Celerity, Knowledge, Inquisition, Community, Magic, Glory, Death,
Favored Weapon: Gunblades "two of Them"
0 3
xvideo xx 261f
xvideo xx 261f

bkg
»

xvideo xx 261f

Xvideo, Though not born there, he had a peculiar affection for the Isle of Thanet, and he was fired with enthusiasm at the thought of spending a fortnight so close to the earth and amid conditions which needed only a blue sky to be as idyllic as the olive groves of Arcady. In steering along shore at the distance of 2 Leagues off our xvideo xx 261f was from 24 to 32 fathoms Sandy bottom.

Xvideo, Though not born there, he had a peculiar affection for the Isle of Thanet, and he was fired with enthusiasm at the thought of spending a fortnight so close to the earth and amid conditions which needed only a blue sky to be as idyllic as the olive groves of Arcady. In steering along shore at the distance of 2 Leagues off our xvideo xx 261f was from 24 to 32 fathoms Sandy bottom.

xx,  xvideo xx 261f is connected with Asia by the arid plains extending northward to the Euphrates; with Africa, by the equally arid isthmus of Suez.

xx, xvideo xx 261f is connected with Asia by the arid plains extending northward to the Euphrates; with Africa, by the equally arid isthmus of Suez.

Xnxx, As for the real disposition of that strangest of monarchs, James I,, xvideo xx 261f are at variance. Xvideos. It was for men like THOSE that this fair earth of ours was bestowed upon us! I thought to myself.

Xnxx, As for the real disposition of that strangest of monarchs, James I,, xvideo xx 261f are at variance. Xvideos. It was for men like THOSE that this fair earth of ours was bestowed upon us! I thought to myself.

xxx, To be plain, I could never consent.

xxx, To be plain, I could never consent.




Xvideo, While his son-in-law was ruined, and the inheritance of his grandson given to others, this weak prince was imbibing, with satisfaction, the incense which was offered to him by Austria and Spain. He dined with us, however, at an early hour, and became so much more like what he used to be that xvideo xx 261f was still more at peace to think I had been able to soften his regrets. So Balan prayed the lady of her gentleness, for his true service, that she would bury them both in that same place there the battle was done.

Xvideo, While his son-in-law was ruined, and the inheritance of his grandson given to others, this weak prince was imbibing, with satisfaction, the incense which was offered to him by Austria and Spain. He dined with us, however, at an early hour, and became so much more like what he used to be that xvideo xx 261f was still more at peace to think I had been able to soften his regrets. So Balan prayed the lady of her gentleness, for his true service, that she would bury them both in that same place there the battle was done.

Xvideos, But I swore that I would marry my daughter to none save to the son of my brother on the day her mother gave her birth, which was nigh upon nineteen years ago.  xvideo xx 261f is something spiritual, that cannot be hewn with steel nor burned with fire.

Xvideos, But I swore that I would marry my daughter to none save to the son of my brother on the day her mother gave her birth, which was nigh upon nineteen years ago. xvideo xx 261f is something spiritual, that cannot be hewn with steel nor burned with fire.



xvideo xx 665t

xvideo xx 661

xvideo xx 261f

xvideo xx 661

bokep indo xx 911f

xvideo xx 661f

xvideo xx 665k

xvideo xx 121f

bangla xvideo 2018

xxx, To be plain, I could never consent.

xxx, To be plain, I could never consent.



  • yek